What are microsatellites?

An even better question might be, “Why teach about DNA?” Why teach elementary-level children a concept that most don’t learn until high school? For an answer, I’ll say that I like to challenge my students, and prompt them to consider hard questions. Even though children don’t always realize that Jurassic Park was a movie (and a book) about the promise and perils of genetic engineering (and not just people getting chased by dinosaurs), Dr. Ian Malcolm summarized a point that I often make to students in the following scene:

One of my greatest joys as a teacher is to pose tough questions, and really get kids thinking. I don’t take sides in the subsequent discussions, but Dr. Malcolm’s statement, “your scientists were so preoccupied with whether or not they could, that they didn’t stop to think whether they should” is an idea that I want students to carry with them as they move on from my science laboratory to middle school and beyond. Should we bring back the woolly mammoth, reconstructing it from ancient DNA? Human hunters most likely played a role in their extinction, so would it be right to bring them back? What about genetic modification to cure a human disorder, even at the risk of side effects, or to reestablish a tree that was once widespread, but is now almost extinct because of a human-spread disease?

The term “GMO” often comes up during these conversations, and that opens another opportunity to discuss what the term actually means. Are dogs GMOs? Maybe not under most people’s definitions, but they certainly are different from their wild ancestors (wolves), and products of mutation and artificial selection. Is what we did with the wolf all that different from what was done to produce varieties of Glofish?

IMG_6913
Image credit: Carlina Aquariums

What about what ancient farmers did with corn?

non-gm-and-gm-corn
Image credit: Random Rationality

Of course, the tools that modern-day molecular biologists use to insert genes into organisms of interest aren’t really all that new; they’ve been used by viruses for millions of years.

500px-GIF-VIRUS-INFECTION1
Image credit: OpenWetWare

Even human DNA is at least 8% viral, which means we (and every other organism alive) have been genetically modified for millions of years! All of these discoveries need to be considered before we jump to conclusions about what is right and wrong in genetics, and I want my students to absorb all of the information before they decide what advances their generation should make.

T. rex JP
Of course, producing genetically engineered dinosaurs might be a little extreme… (Image credit: Universal Pictures)

There are also plenty of useful, real-world uses for genetic analysis, which I am hoping this turtle project will highlight. We certainly won’t be cloning dinosaurs at Riverside School; we’ll be studying the DNA fingerprints of turtles instead. Even better, turtles don’t have teeth, so they can’t eat us even if they tried. Conservation is the most important underlying theme, since these captive (and prolific) box turtles may or may not be a New Jersey “species of concern,” and we’ll also use our detective skills to try and determine how these turtles arrived in our courtyard (and from where). These activities will involve students at an age when they can embrace new concepts as “normal,” and won’t find the prospect of comparing microsatellite markers as too overwhelming… provided that I can present these tasks properly. Too often have I encountered adults, and even teenagers, who’ve passed this critical phase; they react to new discoveries without a sense of wonder, instead dismissing these developments, or even resisting them. In these days when genetic manipulation could become routine and commonplace (see below), we need a new generation that is prepared to face these challenges, and box turtles seem like a good place to present the topic in a locally sourced (and cute) way.

SAMSUNG CSC
Who could resist that face?

Now back to microsatellites. Any time the word “satellite” is mentioned, most people assume it has something to do with space. Not so here. It merely refers to the early isolation of these markers, which first appeared in a “satellite” layer of DNA, rather than where most genes were found. Microsatellites, or simple sequence repeats (SSRs), or short tandem repeats (STRs), or variable number tandem repeats (VNTRs), aside from having a number of interchangeable names (Selkoe and Toonen 2006), are repeated series within an organism’s genetic code, represented by the letters A, T, C, and G. These might be two letters, such as CACACACACACACACACACACACACA, which is actually a box turtle genetic marker (Kimble et al. 2011), or three letters, or a four letter repeat like GATAGATAGATAGATAGATAGATAGATAGATA… which is another box turtle marker (Kimble et al. 2011). The site of each of these repeats is known as a “locus,” and we have tried to measure the lengths of 12 loci (the plural of locus) in 38 turtles so far. Since microsatellites vary in length between turtles, and each baby inherits a copy of each locus from a parent (remember the DNA fingerprinting video in my previous post), we should be able to figure out the parentage of each turtle by comparing their microsatellites with possible mothers and fathers. Anybody who’s ever watched the Maury Povich show surely knows how these tests can play out, although I won’t post any videos (in case children are reading). Our turtles shouldn’t show much emotion, anyway—they’re all fairly laid back.

SDCC13_-_TMNT_(9348046202)
Ninja turtles they aren’t (Image credit: William Tung)

One last word on the names and dates in parentheses that you might read from time to time. These are references to scientific journals that provided information, and they will always be listed at the bottom of a post. There was a day when all references had to be hand typed, but nowadays, they just pop into place with a few clicks. Thank goodness for EndNote!

References

Kimble, S. J. A., J. A. Fike, O. E. Rhodes, Jr., and R. N. Williams. 2011. Identification of 12 polymorphic microsatellite loci for the eastern box turtle (Terrapene carolina carolina). Conservation Genetics Resources 3:65-67.

Selkoe, K. A., and R. J. Toonen. 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecology Letters 9:615-629.

Comments

comments

 

Comments are closed.